What is the stop codon for this mRNA strand?!


Question: What is the stop codon for this mRNA strand?
CAUCGCAUGUCGACUGCUUGCACUAACGCUGC

i know the start is AUG, but isnt after i find the start codon, everything will be in triplets? I saw UAA and thought that would be the stop codon, but it is in a different triplet.

Here was the original question:
Utilizing the correct strand, write out the mRNA strand, find the start codon - & start translating utilizing the table, continue until there is a stop codon. Identify the correct tRNA anticodons for each of the amino acids.

And this is the table: http://content.answers.com/main/content/…

^ I have no idea how im supposed to utilize the table.

Answers:

I just did this for hw for the test tomorrow

Aug is the start

CAU CGC AUG UCG ACU GCU UGC ACG UAA CGC UGC

you missed one when you were translating

the stop is UAA

there is 3 we need to know for the test

UAA UAG UGA

i think I''m in your class



It's either UAA, UAG, or UGA. Those are your stop codons.
You use the table by saying what each mRNA is.
such as:
His. Arg. His. Met.
His is Cau. You know this by looking at the table. you start on the left. choose C then you look up at the top and look at A and look in the CA column and then you find CAU. and next to it, it says CAU. :)
hope i helped.
and i think you might have done it wrong because there aren't any stop codons in there.




The consumer health information on answer-health.com is for informational purposes only and is not a substitute for medical advice or treatment for any medical conditions.
The answer content post by the user, if contains the copyright content please contact us, we will immediately remove it.
Copyright © 2007-2011 answer-health.com -   Terms of Use -   Contact us

Health Categories